Marker Primers & Conditions

Marker Source Primer 1 Sequence 5'---->3' Primer 2 Sequence 5'---->3' [Mg] Anneal ENZYME M
Ac208 L07282 2279 GGTTCATGGTTTCAATTGGC 3285 TATGACGCTATGCACCGTTC [3.5] 55C    
acti D50838 3434 ATCATGAAGTGCGATGTGGACAT 3804 GCCACCACCTTGATCTTCATGGC [3.5] 55C    
alad U19877 571 AGACATGGAAAGTGGCAGGT 1116 GAGGCCCTAACGCCTAAATC [3.5] 55C Mnl I  
Ald X85495 239 TGTCGGCGTCCACCTCCCAG 2053 CCCCGATCGCCATGCACCCACAG [2] 55C Hinf I  
As X52304 2456 CAAAGGTCGAGGAGAAGTCG 3012 AAGAGCACCGACCTGGATTA [3.5] 55C Hae III  
Cac2.1 AV396460 69 GCGCCGCACATCATCCTGAAG 397 TCCATGGTGGGCAGCGACTTG [2] 55C Hha I  
Cac4.1 AV396762 99 CCGCGACCTCCTGCTCA 293 GCGGCCTTGAACTCCAG [2.7] 55C  Fnu4H1  
Cac4.10 AV397464 106 CCCCCGACATTCAAGCAG 437 TCGCCGCTGTAGGTGATG [2.7] 55C Msp I  
Cac4.12 AV396320 39 TCACGCCCAGCACTCAGACAC 194 CGGGGTCCAGGGTCCTCGTTT [2.7] 55C Hae III  
Cac4.4 X80887 157 ATGGGCGGTTCTGTTATTG 1196 GCCCGTCACGAAGCAG [2.7] 55C ScrFI  
Cac4.5 AV394365 10 GCCGGAGAGCCTTGAGTTC 447 ATGCCGACGGGAGTGG [2.7] 55C Pvu II  
Ccs1 U71000 2476 GGAAGGTGGTGATGCAAGTT 2794 CACTATGCAGGAATGGTGA [3.5] 55C Nla III  
Cnc 72 Mets L13 AGTTGTACAGGCGTGAAAATG R375 ACCGGAAATTTTGTGTCCAG [2.7] 55C Rsa  
cpx1 AF133671 2593 GACATCACCCCCAGCTATGT 3532 GTAGGGGTCGTTCATGTGCT [3.5] 55C Msp I  
cyc 6 M67448 159 GCCGCGCCCGAACCGAAATC 1604 GCCCCGCCACTACGCTAACTGACGA [2] 55C Nla III  
Dhc 4 U61367 95 CAGCCCAGCCTAGTTGGTTA 692 AACCAGGGTTCATGGTGATG [2.7] 55C    
Dhc 9 U61372 21 CATCCAGTGCGTGGTGTTC 217 TGAACGTCTTCACCTTGAGC [2.7] 55C    
Dhc3 U61366 144 TCCCCTACCGTAGTAGTCGC 746 TGTGCACACAAATGTACTTAATGC [3.5] 55C    
Dhc6 U61369 70 ACCGACCGCTGCTACCG 873 GATGAACACCGAGAATGTGG [3.5] 55C Mnl I  
Gle D10542 1503 ACATGATCGTGGTCAACGTG 2332 CATGGACGGATCACAAATGA [3.5] 55C    
GP 387 Mets F107 GCTGGTGAGCTGGTGCTAC R732 TGCCATGATGTCATCGTAATG [3.5] 55C    
GP1 Ferris L1985 CTGGAGCTTGCTTGACTGA R2613 GCGGACATGCCTTGAGA [2.7] 55C    
GS2 U46208 163 AGGGCATGATCTTCAACGAG 1519 CGCGAGGAAGAAGTACAAGG [2.7] 55C Nla III  
gsat U03632 233 ATCGTCTTCGACAGGGTCAA 1862 CAGCACTGTCAGCAGCACTT [3.5] 55C Nla III  
Hsp 70a M76725 2673 AGCTGCTGCAGGACTTCTTC 2936 GCTGGTTGTCGGAGTAGGTC [2.7] 55C Hae III  
Hyd1 Mets L1368 GGGGGCGTATTAGCAGTA R1713 ACGCATTCGGTAGCAAGC [2.7] 55C    
Iso Ferris L145 CAGTGTCGCTGGGTTGAG R679 AGGCGGTTTGGGATGG [2.7] 55C Avall  
KF76 U25976 6 ACAGTTACTCCAGGTTATTCAG 216 ATGTGTACGTACGTGTGTGTAG [2.7] 55C    
KF77 U25977 9 GCGGGGTTGGGGTGGTG 153 ATTGGGTTCGGTGCAG [2] 55C    
KF78 U25978 12 GGGGGGGTTCGTGTGTG 121 TCCAGGCAAACACAGAG [2] 55C    
KF79 U25979 24 AAGTCGTAGAAGGGGCGG 174 CTCTGCCTCACAACTGAGA [3.5] 55C    
KF80 U25980 37 CCTCTTAAAGACCAGGCGG 207 GCTCAGCAGCAACACAG [2.7] 55C    
KF81 U25981 18 CAGAGCCACACCTGCGTAG 183 CTTGACGATGTGTACGCCTTG [3.5] 55C    
KF82 U25982 3 CAATCCACCAGCGACAA 199 ACCACCACGTTGCCTAG [2.7] 52/55C    
KF83 U25983 8 GGTGGACAGCAACAAGG 174 GGAGTGGGGCAGGGAG [2.7] 55C    
KF84 U25984 9 GGGTGGATGGGAGGTAG 154 ATGGTATGCGAGTATGCGA [2] 55C    
KF85 U25985 17 CGTGTGGCTTGCGTGTG 147 GCTACTTCCACGTCCTGCA [2.7] 55C    
Lao 1 U78797 116 AAGCAGCCTTGTGGGTAGTG 2108 GTAGCGCAAAACCTGGAGAG [2.7] 55C Msp I  
Lc3 U43610 5 CGAGCCAACTTGCTGTAAAAC 941 ACAGGCGAGGACACAGCTAC [3.5] 55C Scr FI  
Lc6 U19484 112 ATGGCCGACGAGAAGGAG 453 CGGAGTGTCCTTTGATTTCC [3.5] 55C Hae III  
oda 11 L26049 11237 GGCGGCAGCGGCAAGCAGTC 12160 AAGCGGCGGGGGCAAAGCAGG [3.5] 55C    
oda 9 U19120 2200 ACTGATGAGGGGCTTTCG 2623 TCGCGTTCGCTTTACACC [3.5] 55C Msp I  
OEE1 X13826 834 GGAGCTGCTGAAGGAGAACG 1583 AGCGAGTCGGGGAAATAGGG [3.5] 55C Hae III  
OEE3 X13832 903 GTAAGCGCCCTCTTCTTTCC 1452 GAGCCACTCCAGAAGAGCTG [3.5] 55C Hae III  
PC1 U36752 2629 ATCTCTGACCCCAAGCTGAA 3546 ACACTGCACACGAGTTTTGC [2] 55C Hae III  
PRK AF228914 1146 CGACTCCAACACCCTGATCT 2650 CCGCTATATACGCCGGTTT [2.7] 55C    
rpl22a AV388591 51 AAATGGCCCTCCGTGCTT 343 CACCAGAGCCTCCTCGTAAGA [2.7] 55C ScrFl  
S926 X62135 1026 ACACGCATCAAAGGTCACTG 2755 CAGTAACAGGCATCCCCAAA [3.5] 54/57C Cac 81  
A46 AW661509 83 GAACCAGGCCGAGATTGTC 332 GGCGGCCTTCGACTTCTTC [2.7] 55C ScrFI  
B21 Mets L112 CATTGTGGACGCGTCGGCTCTC R324 CCTGCTTATCCTTCTTCTG [2.7] 55C ScrFI  
C28 Mets L11  GGTCTCATCCATTTCCCGA R296 GAAAGGTGTTGGTACCCTGA [3.5] 55C Dde I  
Tctex1 AF039437 487 ATTGACGTCTCGGAAGAGGA 1036 ACCTCCTGTTGCACCATTTC [3.5] 55C Hae III  
TuA1 M11447 284 TACTTTGCTGCTTGCTGTGG 834 GAAGGGGGTAAAGGCAATGT [3.5] 55C Hae III  
UND7   L1 GTGTGAGATTGCAACAGG R1 ATCTTACACGGCCTTACG [3.5] 55C Nde I  
UNI3 AF013108 4318 GGGGTAGCAACCACCTCAG 5324 AGCAGTGTGTCCGAGGAATC [3.5] 55C Fnu4HI  
vfl1a Mets 1135 GAGAAGGCTTGCAGGTTGTG VFL1-R1 CGAAATGCTAGCTTTGTTGC [3.5] 55C Hae III  
vfl1b AF154916 651 TCGGATGACCTAGCGCAAATGAG 961 CTGGCGAGGTTAAGCGATGTGAG [2.7] 55C Ava II  
vsp3 L29029 1447 CCTCCGCCTCCTGTTGA 1779 AGTGTCTGCCCGCCTAA [3.5] 55C Hha I  
yptC6 U13169 1333 ACGCAGACTCCAACATTGTG 1842 CTTCAGATCGCTCTTGTTGC [3.5] 55C Hae III  
zsp1 S44199 264 GAGGTCGCGGGGGAA 1075 GCGAGTGCGGAATCAAA [3.5] 55C Dde I  
zsp2 AF053099 649 CAGGGCGAGTGGAGTGTTA 1272 AACTTTGCGGGGACACGA [2.7] 55C Kpnl a,b,c,d

Last Updated on 7/13/00
By Laurie Mets
Email: l-mets@uchicago.edu